Crispy CRISPR design parameters

* Target DNA Sequence:
Paste the exact target sequence that will be used for design. Here is an example sequence to target the GFP gene:
GAATTCGAGCTCGGTACCCGGGAGATCTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAGATATCTTTACA
GCTAGCTCAGTCCTAGGTATTATGCTAGCTTTGGAATTCATTAAAGAGGAGAAAGGTACCATGAGCAAAGGAGAAGAAC
TTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCCGTGGAGAGGG
TGAAGGTGATGCTACAAACGGAAAACTCACCCTTAAATTTATTTGCACTACTGGA
* Offtarget blast database: